Is the CODIS DNA database useful for genetic genealogy?

Updated: Apr 5, 2021

At some point in your family history career, you might discover the CODIS database and wonder what it s.
The topic of CODIS doesn't always come up because it's not something that we necessarily use in genetic family history. But it is probably the oldest DNA database out there.
What is CODIS?
CODIS stands for the Combined DNA Index System used by law enforcement to do two things. First, to link known offenders to current investigations. Second, to identify missing and unidentified individuals.
How does CODIS identify individuals?
This genetic database looks at short tandem repeats or STRs. You might have heard of this before. In genetic genealogy, a y-DNA test looks primarily looking at a set of STRs.
The CODIS STR database is great for one-to-one comparisons. If you have a known sample and an unknown sample, you can compare them.
If the results match, then samples belong to the same person.
What is a STR?
A STR is a series of letters in the DNA code that has a repeating sequence. For instance, if you have the following:
ACGACGACGACGACGACGACG
You could actually that is really ACG repeated multiple times. As such, the segment would have a value of six ACG repeated six times.
Be it known that these STRs are not just three-letter sequences. In some cases, many letters are then repeated over and over and over.
Since the CODIS database focuses on STRs, even if there is a misread, so long as most of the 20 markers are read, you're going to have enough information to make a definite determination. The STRs are not the same for each person.
We would likely have a different number if we just chose one of these STRs at random. Even if we had the same number at each location, the second STR would have a different number.
To watch this video about CODIS, click the image below.
CODIS includes more than y-DNA STRs
Y-DNA, if you remember, it doesn't undergo a lot of changes. And so, you don't expect a lot of variation between two closely related people.
On the other hand, the CODIS STR database does not use any STRs from the y-DNA. Because only half the population has a y chromosome, it makes sense that all of their STRs actually come from chromosomes 1 through 22.
How accurate are the CODIS matches?
The odds of you and anyone else randomly matching is one in 2.2 x 10 to the 24th power. Or, a 2.2 septillion change of a matching someone else.
To put this number in perspective, modern human beings have been around for about a hundred thousand years. And it's estimated there have been about 100 billion humans born. And now, the majority of that's actually been in the last 100 years. But 100 billion humans in all of history have been born.
Humans would have to exist for another 2.2 trillion years for me to match STRs with another person, unless I have a twin. If you don't have an identical twin, you will not randomly match somebody in the CODIS database.
As such, this resource is a useful tool for law enforcement. Suppose they have a sample from a crime scene and find a suspect. If the suspect and the DNA sample from the scene match, there is almost no chance that that is a random match. This database is far more accurate than many commercial genetic genealogy testing companies.
Courts have been able to use this for about the last 30 years as very definitive evidence. Not only to convict people but also to exonerate people.
↪️ Confused about DNA and genealogy?
Grab your copy of this FREE DNA guide:
Is the CODIS database useful in genealogy research?
CODIS is really good at determining the identity of a person compared to a sample of their DNA. It can not reveal relationships or ancestry. But don't worry because, as genealogists, we don't have access to that database anyway. It is a law enforcement database only.
I don't expect us ever to have access to it. Since it's not that useful for genealogy, I wouldn't be using it even if we could access it.
More about commercial DNA testing
Can DNA Testing Determine Race?
Are DNA Tests Safe? Is it safe to test with a commercial company?
Should You Take a DNA Test if Your Tree is Full?
Convincingly Ask a Relative to Take a DNA Test
Genetic Genealogy: What can it answer? What it can't (video)
.png)



Comments